Involvement of Pex13p in Pex14p Localization and Peroxisomal Targeting Signal 2–dependent Protein Import into Peroxisomes

S. cerevisiae strains used in this study are listed in Table I. Yeast complete (YPD) and minimal media (SD) have been described previously (Erdmann et al., 1989). YNO medium contained 0.1% oleic acid, 0.05% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base without amino acids, adjusted to pH 6.0. When necessary, auxotrophic requirements were added according to Ausubel et al. (1992). For induction of the CUP1 promoter CuSO₄ was added according to Marzioch et al. (1994).

For construction of pRS-PEX7HA₃, the SacI/KpnI fragment of YIp-PEB- HA₃ (Zhang and Lazarow, 1995) was subcloned into low copy plasmid pRS316 (Sikorski and Hieter, 1989). YEp351-PEX14 was constructed by subcloning the SacI/BamHI fragment of pRS-PEX14 into YEp351 (Hill et al., 1986; Albertini et al., 1997). YEp351-PEX13 was constructed by subcloning the XhoI/PstI fragment of pRS-PEX13 into YEp351 (Erdmann and Blobel, 1996).

For construction of Pex14pAXXA and Pex13pE320K, mutations were introduced by PCR using gene splicing by overlap extension (Yon and Fried, 1989). Primers used to construct Pex14pAXXA were: KU107, 5′-(GGAATTCGAGGCCTTATGAGTGACGTGGTCAGT)-3′, (nucleotides [nt] 1–18); RE9, 5′-(ATCCCTGTGGGCCAGCGTTGCTGGCATCGC)-3′, (nt 249–278; underlined nt represent introduced mutations); RE8, 5′-(GCGATGCCAGCAACGCTGGCCCACAGGGAT)-3′, (nt 249–278); and KU109, 5′-(GGGGATCCCGGGATACCTATGGGATGGAGTCTTC)-3′, (nt 1016–1026). pRS-PEX14 (Albertini et al., 1997) served as template. Primers used to construct Pex13p-E320K were T3, 5′-(AATTAACCCTCACTAAAGGG)-3′; RE51, 5′-(CTCTGGGTTTTTTGGAACAAAATC)-3′, (nt 946–969); RE50, 5′-(GATTTTGTTCCAAAAAACCCAGAG)-3′, (nt 946–969); and T7, 5′-(GTAATACGACTCACTATAGGGC). pRS-PEX13 (Erdmann and Blobel, 1996) served as template. The PEX14-PCR product was digested with EcoRI/ BamHI and subcloned into pBluescript SK(+) (Stratagene) resulting in plasmid pWG14/4. The PEX13-PCR product was digested with XhoI/PstI and subcloned into pBluescript SK(+) resulting in plasmid pWG13/13.

For complementation studies, pRS-PEX14 (Albertini et al., 1997) was digested with HpaI/HindIII and the internal fragment of PEX14 (nt 123–702) was exchanged by a HpaI/HindIII fragment of PEX14AXXA from plasmid pWG14/4. The resulting plasmid pWG14/9 contained the PEX14AXXA-ORF as well as 601 bp of the 5′- and 628 bp of the 3′-noncoding region of PEX14. For complementation studies of pex13Δ, the 1.9-kb XhoI/PstI fragment of pWG13/13 containing the PEX13E320K-ORF, as well as 356 bp 5′- and 381 bp 3′-noncoding region of PEX13 were subcloned in the yeast CEN-plasmid pRS351 (Sikorski and Hieter, 1989) resulting in pWG13/15.

The two-hybrid assay was based on the method of Fields and Song (1989). The ORFs of selected PEX genes were fused to the DNA-binding domain or transcription-activating domain of GAL4 in the vectors pPC86 and pPC97 (Chevray and Nathans, 1992). To construct the Gal4p-(BD)- Pex13p fusion, the EcoRI/SpeI fragment of plasmid pSP43D (Erdmann and Blobel, 1996) containing the complete ORF of PEX13 was subcloned into pPC86 resulting in pPC86-PEX13. To construct the Gal4p(DB)- Pex14pAXXA fusion, the 1.1-kb EcoRI/SacII fragment from pWG14/4, containing the complete PEX14AXXA-ORF was subcloned into EcoRI/ SacII-digested pPC86. The resulting plasmid was designated pWG14/6. The SalI/SacII of pWG14/6 contained PEX14AXXA and was subcloned into SalI/SacII digested pPC97, resulting in plasmid pWG14/8.

The PEX13E320K ORF was amplified from plasmid pWG13/13 by PCR, using oligonucleotides 43fus1 5′-(GTGAATTCGGATCCATATGTCATCCACAGCAGTA)-3′ and the T7-primer (see above). The resulting PCR fragment was subcloned into a EcoRI/SpeI digested pPC86, resulting in plasmid pWG13/18. Amino acids 286–386 of Pex13pE320K were amplified by PCR using primers 37hyb1 5′-(TCCAGAATTCGGATCCTACAGACCTCTGGAACCATA)-3′, T7, and pWG13/13 as templates. The PCR product was subcloned with EcoRI/SpeI into pPC86, resulting in plasmid pWG13/16. Subsequently, pWG13/16 was digested with SmaI/SpeI, and the excised PEX13E320K fragment was subcloned into SmaI/SpeI digested pPC97, resulting in plasmid pWG13/19.

Constructions of the Gal4p-AD-Pex5p, Gal4p-DB-Pex7p, and Gal4p-AD-Pex14p fusion proteins have been described previously (Erdmann and Blobel, 1996; Rehling et al., 1996; Albertini et al., 1997). Cotransformation of two-hybrid vectors into the PCY2 and HF7c was performed according to Gietz and Sugino (1988). Double transformants were selected on SD synthetic medium without tryptophane and leucine. β-galactosidase activity of transformed cells was determined by a filter assay described by Rehling et al. (1996), using X-Gal (GIBCO BRL) as substrate. His auxotrophy of transformed HF7c was determined by growth on selective plates lacking leucine, tryptophane, and histidine, but containing 10 mM 3-aminotriazole.

To delete PEX5, PEX13, PEX14, and PEX17 in the yeast two-hybrid reporter strains PCY2 and HF7c, as well as the deletion of PEX7 and PEX13 in wild-type UTL7A, PEX14 in pex17Δ, PEX17 in pex13Δ, and PEX5 in pex14Δ, the kanMX4 gene was used as a selective marker for insertion into the genomic locus (Wach et al., 1994). Deletion cassettes containing the kanMX4 gene and the 5′ and 3′ untranslated regions of the corresponding ORFs were constructed by PCR using pFA6a-kanMX4 (Wach et al., 1994) as a template. To generate the deletion cassettes for the PEX5 gene deletion, the primer sets KU301, 5′-(TATACATCAATAAACAATATATCATAACACATGGACGTACGTACGCTGCAG- GTGGAC)-3′ and KU302, 5′-(TGATGCGAGAACATAAAATTGCGGAGAACCATATCAATCGATGAATTCGAGCTCG)-3′ were used. For the PEX13 gene deletion, the primer sets KU274, 5′-(TATCTATAAATATCAAGGGGATTCTATACTATAACAATACCTGCGC-GTACGCTGCAGGTCGAC)-3′ and KU275, 5′-(TTTACTATATATATATGCGAATATATG TG TGCAAATATTGATGCAATCGATGA- ATTCGAGCTCG)-3′ were used. For the PEX7 gene deletion, KU371, 5′- (GTTAACGGAC TAT CATC TAAC TTTTTGCATAATTTATACAACATGCGTACGCTGCAGGTCGAC)-3′ and KU372, 5′-(GTTTAAATAATGCAAAAAATTTGTGTAAAAAGAATATGTGTCAACATC- GATGAATTCGAGCTCG)-3′ were used. For PEX14 gene deletion, the primer sets KU289, 5′-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3′ and KU290, 5′- (AATTACAATTTCCG TTAAAAAAC TAATTACTTACATAGAAATTGCGATCGATGAATTCGAGCTCG)-3′ were used. Finally, for a PEX17 gene deletion the primer sets KU251, 5′-(TCCATCATTCT GATAAGCAGAACCACG TAAGGCAGAC TAAAATCCG TAC-GCTGCAGGTCGAC)-3′ and KU273, 5′-(ACGTGCACTAGAGCGTTTTAAATTCAATGCTATTATTTTTGATTGATCGATGAATTCG- AGCTCG)-3′ were used.

For construction of the double knockout strain pex5/14Δ, the PEX14 locus was replaced by the loxP-kanMX4-loxP cassette (Güldener et al., 1996). The PEX14 deletion cassette was constructed by PCR with the primer set KU289, 5′-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3′ and RE24, 5′- (CAATTTCC GTTAAAAAAC TAATTAC TTACATAGAA TTGCGATAGGCCACTAGTGGATCTG)-3′ with plasmid pUG6 as template (Güldener et al., 1996).

The loxP-kanMX4-loxP cassette was integrated into the PEX14 locus and excised afterwards by the CRE recombinase expressed from plasmid pSH47 (Güldener et al., 1996). Subsequently, PEX5 was deleted as described above.

PCRs and selection for geneticin resistance of transformants were performed according to Wach et al. (1994). Authenticity of each gene deletion by integration of the kanMX4 gene was confirmed by PCR.

Spheroplasting of yeast cells, homogenization, and differential centrifugation at 25,000 g of homogenates were performed as described previously (Erdmann et al., 1989).

For subfractionation by flotation gradient centrifugation, solid sucrose was added to a cell free extract, for a final concentration of 50% (wt/wt). 7 ml of this extract was overlaid with 5 ml 46% (wt/wt), 15 ml 38% (wt/wt), and 3 ml 25% (wt/wt) sucrose in gradient buffer (5 mM MES, 1 mM EDTA, 1 mM KCl, 0.1% [vol/vol] ethanol). Gradients were centrifuged in a Sorvall-SV288 rotor at 20,000 rpm for 4 h. 27 fractions were collected from the bottom and processed for enzyme measurement and Western blotting.

3-oxoacyl-CoA thiolase (EC 2.3.1.16), catalase (EC 1.11.1.6), and fumarate hydratase (fumarase: EC 4.2.1.2) were assayed according to published procedures (Moreno de la Garza et al., 1985; Veenhuis et al., 1987).

The peroxisomal peak fractions of a sucrose density gradient were pooled and subsequently diluted fivefold in gradient buffer (Erdmann and Blobel, 1995). Peroxisomes were concentrated by centrifugation at 25,000 g for 30 min. The resultant pellet was resuspended in homogenization buffer (Erdmann et al., 1989) supplemented with 50 mM KCl, but without protease inhibitors. Equal amounts of isolated peroxisomes were incubated for 10 min on ice with increasing amounts of proteinase K. The proteinase was inhibited by the addition of 4 mM PMSF. The proteins were then precipitated with TCA and the samples were processed for SDS-PAGE.

The protein fusion and purification system of New England Biolabs was used for overexpression of a maltose-binding protein–SH3 domain fusion protein (MBP-SH3). Amino acids 286–386 of Pex13p comprising the SH3 domain of Pex13p were fused to the COOH terminus of the Escherichia coli MBP (Erdmann and Blobel, 1996). MBP-SH3 was expressed from pMAL-SH3 in E. coli strain TG1. The expression was induced with 0.3 mM isopropyl-β-d-thiogalactopyranoside (IPTG), and affinity purification of the MBP-SH3 fusion protein on amylose resin was performed according to the manufacturer's protocol. Polyclonal antibodies were raised against the fusion protein (Eurogentec).

Rabbit polyclonal anti-Pex11p antibodies were raised against a synthetic peptide (KAKSQSQGDEHEDHK) corresponding to amino acids 162–176 generated by Eurogentec.

Antithiolase (Fox3p; Erdmann and Kunau, 1994), anti-Pcs60p (Blobel and Erdmann, 1996), anti-Pex3p (Höhfeld et al., 1991), anti-Pex5p (Albertini et al., 1997), anti-Pex14p (Albertini et al., 1997), anti-Pex17p (Huhse et al., 1998), and anti–fructose 1,6 bisphosphatase (anti-Fbp1p; Bigl and Escherich, 1994) have been described previously. Anti–rabbit or anti–mouse IgG-coupled HRP (Nycomed Amersham) was used as a secondary antibody, and blots were developed using the ECL-system (Nycomed Amersham). Western blot analyses were performed according to standard protocols (Harlow and Lane, 1988).

Coimmunoprecipitation experiments were performed as described in Rehling et al. (1996) with the exception of omitting the 35,000 g sedimentation step.

Immunofluorescence microscopy was performed according to the procedure of Rout and Kilmartin (1990), with modifications previously described in Erdmann (1994). Rabbit antisera against thiolase were used at dilutions of 1:3,000. For detection, 6 μg/ml solution of CY3-conjugated donkey anti–rabbit (Jackson ImmunoResearch Laboratories) was used. HA-tagged Pex11p was detected with monoclonal 12CA5 antiserum (BAbCO; dilution of 1:1,000).

Yeast cells were grown on 0.3% SD medium to late log phase and subsequently for 15 h in YNOD (0.1% dextrose, 0.1% oleic acid, 0.05% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base). Cells were washed with dH₂O and 1 g was used per sedimentation. 3 ml of buffer A (50 mM Tris-HCl, pH 7.5, 50 mM NaCl), protease inhibitors (0.02% PMSF [Serva], 15 μg/ml bestatin, 1.5 μg/ml pepstatin, 1 μg/ml leupeptin, 0.1 μg/ ml chymostatin [Boehringer Mannheim], 0.21 mg/ml NaF), and 3 g glass beads (0.5 mm) were added to the cells. Breakage was achieved by vortexing for 4 min (8 × 30 s, with breaks ≥30 s on ice; Lamb et al., 1994). Samples were filtered through cotton wool, and the filtrate was transferred to Corex tubes and centrifuged at 1,000 g for 30 min. Supernatants were normalized for protein and volume, and membranes were sedimented at 200,000 g for 30 min (Sorvall AH650, 40,850 rpm) through a cushion of 0.25 M sucrose in buffer A. The resulting pellet was resuspended in buffer A plus protease inhibitors corresponding to the volume of the supernatant. Aliquots of the samples were analyzed by SDS-PAGE.

It has been reported that the import receptors Pex5p and Pex7p interact with each other in the yeast two-hybrid system, which opened the possibility that both proteins may form a heteromeric cytosolic signal recognition complex (Rehling et al., 1996). However, the yeast two-hybrid system does not necessarily distinguish between a direct and indirect binding of two S. cerevisiae proteins, as endogenous proteins may contribute to the observed interaction. As Pex14p can bind both import receptors, we investigated whether the Pex5p/Pex7p interaction is still observed in a yeast two-hybrid reporter strain deleted for the genomic copy of PEX14 (Huhse et al., 1998). As shown in Fig. 1, the interaction of the two import receptors strictly depended on the presence of Pex14p which may be required for the activation of either receptor, or it may function as a bridging molecule between Pex5p and Pex7p.

Deletion of genes encoding the three components of the docking machinery known to date, Pex13p, Pex14p, or Pex17p, results in an import defect for both PTS1 and PTS2 proteins. One possible explanation could be a functional overlap of the proteins in PTS1- and PTS2-dependent protein import into peroxisomes. This prediction prompted us to search for additional Pex7p-binding proteins at the peroxisomal membrane. We expressed a functional mycPex7p fusion protein (Marzioch et al., 1994) in wild-type, pex17Δ, pex14Δ, and pex13Δ cells, and determined the localization of the protein by subcellular fractionation studies. Fractions were analyzed for the presence of mycPex7p and for peroxisomal membrane markers Pex14p and Pex13p, as well as for cytosolic Fbp1p (Entian et al., 1988) as a control for proper separation. Pex14p and Pex13p, but not Fbp1p, pelleted, indicating the complete sedimentation of cytosol-free peroxisomal membranes (Fig. 2). As reported previously (Rehling et al., 1996), mycPex7p was predominantly found in the soluble fraction in wild-type cells, while a low but significant amount was detected in the membrane fraction. A decrease of mycPex7p in the pellet fraction of pex14Δ cells (Fig. 2) suggests that the majority of sedimentable Pex7p associates with membranes in a Pex14p-dependent manner. However, in pex14Δ cells a significant amount of mycPex7p was detected in the membrane pellet fraction (Fig. 2), indicating that next to Pex14p additional binding factors for Pex7p exist at the peroxisomal membrane.

To determine the binding partners of Pex7p, we isolated mycPex7p from wild-type and various pex mutant strains by immunoprecipitation, and immunoblotted for the presence of selected peroxins. As reported previously, we found Pex5p, Pex13p, Pex14p, and Pex17p associated with mycPex7p when the receptor was precipitated from wild-type or complemented pex7Δ cells (Albertini et al., 1997; Huhse et al., 1998). Comparison of the constituents of the precipitates revealed five interesting observations.

First, in pex14Δ and pex5Δ/pex14Δ strains, Pex13p still coimmunoprecipitated with mycPex7p (Fig. 3), suggesting that Pex13p associates directly or indirectly with Pex7p. Moreover, this result indicated that neither Pex14p nor Pex5p is required for the formation of this subcomplex of Pex13p and Pex7p. Second, the amount of Pex5p in the precipitate from pex14Δ cells was drastically reduced, while the amount in Pex13p remained essentially unchanged (Fig. 3, lane pex14Δ). This result supports the notion that the amount of Pex5p bound to Pex13p does not determine the stoichiometry of the Pex13p-Pex7p subcomplex. However, it also suggests that Pex13p may not bind both import receptors equally at the same time. Third, Pex13p, Pex14p, and Pex5p still coimmunoprecipitated with Pex7p in pex17Δ cells (Fig. 3, lane pex17Δ). Obviously, Pex7p is associated with components of the peroxisomal translocation machinery in the absence of Pex17p, suggesting that the presence of Pex17p is not a prerequisite for docking of Pex7p to the peroxisomal membrane. Fourth, the lack of Pex17p in the coimmunoprecipitate from pex14Δ cells (Fig. 3, lane pex14Δ), suggests that Pex14p is required for the association of Pex17p with the complex, and is consistent with the assumption that Pex17p binding to the complex may be via Pex14p. However, this observation must be interpreted with care since the pex14Δ cells contain much less immunologically detectable Pex17p (Huhse et al., 1998). Finally, the amount of Fox3p that coimmunoprecipitates with Pex7p drastically increases in mutants with an import defect for PTS2 proteins (pex17Δ, pex13Δ, pex14Δ, and pex5Δ/pex14Δ) relative to the strains unaffected in this pathway (wild-type and pex5Δ). Since the total amount of both proteins is similar in all strains (Fig. 3 B), it seems unlikely that the observed Pex7p/Fox3p complex has formed in vitro after cell disruption. A simple explanation for this may be that the high cytosolic concentration of thiolase in the import mutants results in greater occupation of the PTS2 receptor.

To exclude the possibility of nonspecific coprecipitation of proteins, we checked the precipitates for the presence of peroxisomal membrane proteins Pex11p (Erdmann and Blobel, 1995; Marshall et al., 1995) and Pmp35p (putative peroxisomal ATP-transporter; Erdmann, R., unpublished observations). These proteins were not detected in any of the samples, indicating the specificity of the observed interactions (data not shown).

The observed in vivo association of Pex7p with Pex13p in cells lacking Pex14p and Pex5p encouraged us to analyze the interaction of these proteins in more detail. In previous experiments, only fragments of Pex13p were used to address whether Pex13p binds to Pex7p, and so far they have not indicated an interaction between these two proteins (Erdmann and Blobel, 1996). To revisit this possibility, we analyzed the interaction of the full length Pex13p with Pex7p in the yeast two-hybrid system. The results shown in Fig. 4 A reveal that the full length Pex13p is indeed able to interact with the PTS2-receptor Pex7p. The controls included show that coexpression of either of the fusion proteins alone did not support transcription activation of the reporter genes.

To analyze whether the observed Pex13p/Pex7p two-hybrid interaction depends on known binding partners for Pex13p, tests were also performed in isogenic pex5Δ and pex14Δ strains (Fig. 4 A). Furthermore, we analyzed the association of Pex7p with a mutated Pex13pE320K in a pex5Δ mutant (Fig. 4 B). Because Pex13pE320K lost the ability to interact with Pex14p in the yeast two-hybrid system (Fig. 4 B, see also Fig. 8), this experiment was expected to monitor the Pex13p/Pex7p interaction upon simultaneous elimination of the Pex14p and Pex5p influence. As shown in Fig. 4, these two-hybrid analyses did not reveal an influence of Pex5p or Pex14p on the Pex13p/ Pex7p interaction. No difference was observed independent of whether the Pex7p/Pex13p interaction was analyzed in wild-type, pex5Δ, or pex14Δ strains (Fig. 4 A), or for the Pex7p/Pex13pE320K interaction in pex5Δ cells (Fig. 4 B). These results indicate that neither Pex14p nor Pex5p is required for the in vivo interaction of Pex7p with Pex13p, and therefore are in agreement with results obtained in the coimmunoprecipitation experiment (Fig. 3).

The two-hybrid interaction of the complete Pex13p with Pex14p is only detected by histidine prototrophy (Fig. 4 B), indicating that regions NH₂-terminal of the SH3 domain of Pex13p may weaken the interaction of these proteins in the two-hybrid system.

Mutant cells lacking Pex7p are characterized by their inability to grow on oleic acid as the sole carbon source (Fig. 5 A) and by mislocalization of peroxisomal thiolase to the cytosol (Marzioch et al., 1994; Zhang and Lazarow, 1995). Expression of a COOH-terminally HA-tagged Pex7p from the low copy plasmid pRSPEX7-HA₃ leads only to a partial complementation of the pex7Δ mutant phenotype (Zhang and Lazarow, 1995). This is indicated by the inability of the transformants to grow on oleic acid plates (Fig. 5 A) and a reduced ability to import Fox3p (thiolase) into peroxisomes. The latter is evident by the pronounced cytosolic mislocalization of this protein (Fig. 5 B, panel d). This mutant phenotype of pex7Δ[pRSPEX7-HA₃] was employed to investigate whether overexpression of Pex7p-binding partners may suppress a defect in Pex7p function. Cells expressing Pex7p-HA₃ were transformed with multicopy plasmids containing either PEX14 or PEX13 under the control of their own promoters. As judged by their growth characteristics on oleic acid medium (Fig. 5 A) and by the fluorescence pattern for thiolase (Fig. 5 B), overexpression of PEX13, but not PEX14, rescued the mutant phenotype caused by the defective Pex7p-HA. Even though the suppression was not as efficient as complementation with the wild-type PEX7, this observation demonstrates that Pex13p can suppress the mutant phenotype of pex7Δ[pRSPEX7-HA₃], providing genetic evidence for an interaction between Pex7p and Pex13p.

Pex13p is an integral peroxisomal membrane protein and the cytosolic orientation of the COOH-terminal SH3 domain was shown previously in human fibroblasts (Elgersma et al., 1996) and Pichia pastoris (Gould et al., 1996). However, the COOH-terminal SH3 domain alone is not sufficient to interact with Pex7p, suggesting that regions NH₂-terminal to the SH3 domain are involved in this association. To address whether the NH₂ terminus of Pex13p is localized to the lumen of peroxisomes or to the cytosol, we analyzed the accessibility of an NH₂-terminally myc-tagged Pex13p to exogenously added protease K. The tag has been shown previously not to affect the function of Pex13p (Erdmann and Blobel, 1996). Thus, the topology of the myc-tagged Pex13p is likely to reflect the in vivo situation for the wild-type protein. As judged by immunoblot analysis, both the NH₂-terminal myc-tag as well as the SH3 domain of Pex13p were rapidly degraded by the protease (Fig. 6). Intraperoxisomal thiolase remained stable under these conditions and was only degraded in the presence of detergents (data not shown). From this data, we conclude that both the NH₂ terminus and the COOH-terminal SH3 domain are exposed to the cytosol. This result also implicates the presence of an even number of transmembrane spans within Pex13p.

Pex13p interacts with Pex14p via its COOH-terminal SH3 domain (Albertini et al., 1997; Brocard et al., 1997); however, both proteins can interact with Pex7p independently. The latter is in agreement with the assumption that Pex13p and Pex14p contribute to distinct docking sites for Pex7p at the peroxisomal membrane. Since Pex14p is a peripheral membrane protein, two questions arise: How is it associated with the peroxisomal membrane, and Does Pex13p contribute to its localization? In an attempt to identify proteins required for the targeting and binding of Pex14p to the peroxisomal membrane, we analyzed the subcellular localization of Pex14p in different pex-mutant cells (Fig. 7 A). The congruent fluorescence patterns for Pex14p and the peroxisomal membrane marker Pex11p in pex17Δ cells indicate a peroxisomal localization of Pex14p. This observation suggests that Pex17p is not required for the targeting of Pex14p to the peroxisomal membrane. In contrast, no congruent fluorescence patterns were observed in pex13Δ cells. Since the HA-tagged Pex11p is known to be targeted to peroxisomal membrane ghosts in pex13Δ cells (Erdmann and Blobel, 1996), the lack of congruence suggests that the majority of Pex14p is mislocalized. To confirm this result by independent means, we performed a flotation of wild-type, pex13Δ, and pex17Δ homogenates in sucrose gradients (Fig. 7 B). Gradients were designed such that peroxisomal membrane ghosts would float to the upper fractions of the gradient, whereas intact peroxisomes would predominantly remain in the loading zone. In pex13Δ cells, the peroxisomal membrane markers Pex3p and Pex11p were predominantly found in fractions that correspond to the peroxisomal membrane ghosts. However, Pex14p was not detected in these fractions, but was found to cosegregate with mitochondrial fumarase. These data suggest that the peroxisomal membrane ghosts in pex13Δ cells lack Pex14p. Thus, the presence of Pex13p is a prerequisite for peroxisomal membrane association of Pex14p. Pex13p could be involved in targeting, or it could be required for binding or retention of Pex14p at the peroxisome.

To clarify whether binding of Pex14p to the SH3 domain is a prerequisite for the peroxisomal targeting of Pex14p, we analyzed the subcellular localization of Pex14p under conditions in which this interaction is blocked. A proline-rich sequence which corresponds to a type II SH3 domain binding motif is present within the primary sequence of Pex14p (Albertini et al., 1997; Brocard et al., 1997). We substituted Pro87 and Pro90 of this putative binding motif (PPTLPHRDW) by two alanines (PATLAHRDW). Remarkably, the mutated Pex14pAXXA still complemented the peroxisome biogenesis defect of pex14Δ cells (data not shown). We also introduced an E320K mutation in the reverse transcriptase loop (RT loop) of the SH3 domain of Pex13p. This mutation has been reported to result in the inactivation of Pex13p function (Elgersma et al., 1996). As shown in Fig. 8, the mutated Pex14pAXXA had lost the ability to bind Pex13p in the yeast two-hybrid system while binding to Pex5p, Pex7p, and oligomerization of the protein was unchanged. Also the E320K mutation of Pex13p abolished the two-hybrid interaction of the SH3 domain of Pex13p with Pex14p (Fig. 8). These results suggest that strong interactions between Pex14p and the SH3 domain of Pex13p are dependent on the PXXP motif within Pex14p, as well as on the RT loop of the SH3 domain of Pex13p.

Next, we analyzed the Pex14pAXXA (Fig. 9 A) association with peroxisomal membrane ghosts of pex14Δ/pex17Δ double mutants which were predicted to contain peroxisomal membrane ghosts even upon complementation of the pex14Δ mutation. In addition, we analyzed whether peroxisomal membrane ghosts that harbor mutated Pex13pE320K still contain Pex14p. The subcellular localization of Pex14p, Pex14pAXXA, and peroxisomal membrane markers was analyzed by double immunofluorescence microscopy and flotation analysis. Colocalization was observed for HA-Pex11p and Pex14pAXXA in pex14Δ cells, as well as for HA-Pex11p and Pex14p in pex13Δ cells expressing Pex13pE320K, indicative of peroxisomal membrane association of these proteins (Fig. 9 A). These results were corroborated by flotation analysis which revealed that Pex14pAXXA was associated with the fraction containing the peroxisomal membrane ghosts of pex14Δ/pex17Δ, as were Pex14p in pex13Δ/pex17Δ cells expressing Pex13pE320K (Fig. 9 B). These observations suggest that Pex14p is associated with peroxisomes and peroxisomal membrane ghosts independent of interaction between the proline-rich motif of Pex14p and the RT loop in the SH3 domain of Pex13p. Interestingly, the fractionation of pex13Δ/ pex17Δ[PEX13E320K] shows that, although the RT loop of the SH3 domain of Pex13p is not absolutely required for the targeting of Pex14p to the membrane of peroxisomal ghosts, it appears to enhance or stabilize the targeting, as only Pex14p trails through the gradients of this mutant strain (Fig. 9 B).

The peroxisomal membrane protein Pex14p has been reported to bind both the PTS1 and the PTS2 receptor, which led Albertini et al. (1997) to the conclusion that Pex14p may represent the point of convergence of the PTS1- and PTS2-dependent protein import pathways at the peroxisomal membrane. Here, we report that Pex13p is also involved in both the PTS1- and PTS2-dependent protein import into peroxisomes. Pex13p interacts directly or indirectly with the PTS2 receptor Pex7p and overexpression of Pex13p suppresses the protein import defect caused by a functionally impaired epitope-tagged Pex7p. Pex13p is also shown to be required for the peroxisomal association of Pex14p; however, evidence is provided that the SH3 domain of Pex13p may not represent the only binding site for Pex14p at the peroxisomal membrane.

The SH3 domain of Pex13p has been reported to interact with the PTS1 receptor Pex5p and with Pex14p (Elgersma et al., 1996; Erdmann and Blobel, 1996; Gould et al., 1996; Albertini et al., 1997; Fransen et al., 1998; Fig. 8). A mutation in the RT loop of the SH3 domain of Pex13p, as well as a mutation of a putative class II SH3 ligand motif of Pex14p abolished the two-hybrid interaction of both proteins (Fig. 8), supporting the notion of a typical SH3 domain-ligand interaction between Pex13p and Pex14p. Interestingly, although the E320K mutation of the RT loop of the SH3 domain of Pex13p abolishes its two-hybrid interaction with Pex14p, the mutated SH3 domain still interacts with Pex5p (Fig. 8 B). Accordingly, we conclude that there are distinct binding sites for both Pex5p and Pex14p within this domain or adjacent regions contained within the construct used for the assay.

Remarkably, neither the E320K mutation of the SH3 domain of Pex13p nor the mutation of the proline-rich motif of Pex14p prevented the peroxisomal localization of Pex14p (Fig. 9). This observation suggests that the binding of Pex14p to the SH3 domain of Pex13p is not absolutely required for the targeting and binding of Pex14p to peroxisomes. Why then does the absence of Pex13p lead to the mistargeting of Pex14p (Fig. 7)? One possibility is that Pex13p is a component of a protein complex at the peroxisomal membrane that may disintegrate in the absence of the entire protein, but remains stable without the SH3-dependent interaction between Pex13p and Pex14p. Association of Pex14p with the complex may not require a direct interaction with Pex13p, but may be mediated by other components of the complex. The simplest explanation for our observations on the Pex13p/Pex14p interaction is the existence of an as yet unrecognized binding partner for Pex13p that may also provide the binding site for Pex14p at the peroxisomal membrane. This missing link, however, is not Pex17p. It is true that Pex17p is another binding partner of Pex14p, but our data suggest that Pex17p is not required for association of the Pex13p/ Pex14p/Pex5p/Pex7p complex, as all these components can efficiently coprecipitate in the absence of Pex17p (Fig. 3). Moreover, we found no Pex17p in a precipitate from pex14Δ cells that still contains Pex13p and Pex7p (Fig. 3), leading to two conclusions. First, a subcomplex of Pex13p and Pex7p can form in the absence of Pex14p and Pex17p, and second, Pex14p is required for the association of Pex17p with the complex. The latter may be explained by the assumption that Pex17p is bound to the complex via Pex14p.

The amount of Pex7p in the membrane sediment of pex14Δ cells is significantly lower than in wild-type or pex13Δ cells (Fig. 2), suggesting that Pex14p may contribute to the majority of the total binding capacity of the peroxisomal membrane for the PTS2 receptor. However, a significant amount of Pex7p was sedimented in the absence of Pex14p (Fig. 2, lane pex14Δ). Interestingly, in cells lacking both Pex13p and Pex14p, no Pex7p was found in the membrane pellet, which suggests that Pex13p contributed to the remaining Pex7p associated with peroxisomal membranes of pex14Δ cells (data not shown). This result, however, has to be interpreted with care since the double deletion of PEX13 and PEX14 did result in a significant decrease in immunologically detectable Pex7p (Girzalsky, W., and R. Erdmann, unpublished observations).

The observations that Pex13p and Pex7p interact in the two-hybrid system and can be efficiently coimmunoprecipitated indicate that the proteins interact in vivo (Figs. 3 and 4). Whether Pex13p directly binds Pex7p remains to be shown. Attempts to demonstrate direct binding of the proteins by coimmunoprecipitation of in vitro translated proteins were unsuccessful (data not shown). Our data do not exclude the existence of a bridging protein which would directly interact with both Pex13p and Pex7p, a requirement fulfilled by Pex14p. However, two observations indicate that the hypothetical bridging protein is not one of the known binding partners for Pex13p. First, the Pex7p/Pex13p interaction is also observed in the absence of these proteins (Figs. 3 and 4), and second, the COOH-terminal SH3 domain alone is sufficient for the Pex13p/ Pex14p and Pex13p/Pex5p two-hybrid interaction, but not for the interaction of Pex13p with Pex7p (Erdmann and Blobel, 1996). A direct interaction of Pex13p and Pex7p is further suggested by the genetic suppression of the defect caused by a functionally compromised HA-tagged Pex7p by overexpression of Pex13p (Fig. 5).

As discussed above, a Pex5p/Pex7p two-hybrid interaction is not observed in pex14Δ (Fig. 1). At first, this observation seems rather surprising, since both Pex5p and Pex7p independently interact with Pex13p in the two-hybrid system (Fig. 4). One could imagine that Pex13p may serve as a bridging molecule between the import receptors to mediate an indirect binding which could have emerged in the two-hybrid system. However, the amount of Pex5p simultaneously associated with the Pex7p-Pex13p complex may be too low to give a positive response. In support of this assumption, the amount of Pex5p coimmunoprecipitating with Pex7p in the absence of Pex14p is extremely reduced, despite the presence of significant amounts of Pex13p (Fig. 3, lane pex14Δ). Perhaps Pex13p does not usually associate simultaneously with both of the import receptors, or association is transient.

The domain of Pex13 that interacts with Pex7p, as well as the side of the peroxisomal membrane where the interaction occurs, remains unknown. Furthermore, the intracellular localization of Pex7p in yeast is still a matter of debate. One group has reported that the protein is exclusively localized in the peroxisomal lumen (Zhang and Lazarow, 1995, 1996), whereas others found the protein to be predominantly localized in the cytosol with a small amount associated with the peroxisomal membrane (Marzioch et al., 1994; Rehling et al., 1996). Because the SH3 domain alone does not mediate the interaction with Pex7p, we suggest that regions NH₂-terminal of the SH3 domain may be required for the interaction or contribute to the correct conformation of the binding site. Previously, the COOH-terminal SH3 domain has been reported to face the cytosol (Elgersma et al., 1996; Gould et al., 1996), and we found that both the NH₂ terminus and the COOH terminus of Pex13p are exposed to the cytosol (Fig. 6), suggesting that the protein traverses the membrane with an even number of membrane spans. In this respect, it is interesting to note that two regions which would fulfill the requirement for α-helical transmembrane segments are present in Pex13p (Elgersma et al., 1996).

The interaction of Pex13p with Pex7p has far reaching implications for our understanding of protein import into the peroxisomal matrix. Why are there several binding sites for the import receptors at the peroxisomal membrane? One hypothesis suggests that the multiple interactions reflect the existence of an import cascade in which the cargo-loaded import receptors are transferred from one component of the import complex to the next (Erdmann et al., 1997). Our confirmation that at least two peroxisomal membrane proteins bind the receptors raises concerns about which functions as the docking protein for each of the import pathways. Experimental evidence that Pex13p may be the docking protein for the PTS1 receptor has been provided (Gould et al., 1996), but the unsolved questions stress the need for reliable in vitro systems to study the order of interactions during the process of peroxisomal protein import.

We are grateful to Ulrike Freimann, Uta Ricken, and Sigrid Wüthrich for technical assistance. We thank Paul Lazarow for the plasmid YIpPEB1-HA₃ and William B. Snyder, Gabriele Dodt, Michael Linkert, and Michael Schwierskott for reading of the manuscript.

Fbp1p

fructose 1,6 bisphosphatase

Fox3p

antithiolase

MBP-SH3

maltose-binding protein SH3 domain fusion protein

nt

nucleotide

ORF

open reading frame

PTS

peroxisomal targeting signal

RT loop

reverse transcriptase loop

SD

minimal media

YPD

yeast complete media