Skip to Main Content
Table 1

Primers Used to Amplify Various Gonococcal DNA Sequences

PrimersDNA sequenceAccession no.
JL50 CTGAATTCGGCCGACATCGCGCTTTTGGGCG U15992 
JL51 ATGGATCCGGGGCGATTTTACCTAGCAGATGAA U15992 
RFAK-F GGAGGATCCATGGAAAAAGAATTCAGGATA U39810 
RFAK-R GTTGGATCCAAGGCTTTCAGACGGC U39810 
LgtDfixF GGATCGCGAGAACCGATGCCGACGATATTGCCT U15992 
LgtDfixR GGTTCTCGCGATATATTCTCCACCTCCGCCACCCGACTTTGCCATTCGTCCAGCCCGAT U15992 
LgtCfixF TTACTCCGCGGAGGTGGTAATATCCGCTTTATAGACGTA U15992 
LgtCfixR TTACCCGCGGAGATTGGCGGCAACCGCCGCCCGGTT U15992 
196-230-F CTGTGCATGCCATGTTTTCGGAGAGGACG AF076919 
196-1140-R CCCGAGCTCAAAGGATAAAGGCAAAATGCC AF076910 
PrimersDNA sequenceAccession no.
JL50 CTGAATTCGGCCGACATCGCGCTTTTGGGCG U15992 
JL51 ATGGATCCGGGGCGATTTTACCTAGCAGATGAA U15992 
RFAK-F GGAGGATCCATGGAAAAAGAATTCAGGATA U39810 
RFAK-R GTTGGATCCAAGGCTTTCAGACGGC U39810 
LgtDfixF GGATCGCGAGAACCGATGCCGACGATATTGCCT U15992 
LgtDfixR GGTTCTCGCGATATATTCTCCACCTCCGCCACCCGACTTTGCCATTCGTCCAGCCCGAT U15992 
LgtCfixF TTACTCCGCGGAGGTGGTAATATCCGCTTTATAGACGTA U15992 
LgtCfixR TTACCCGCGGAGATTGGCGGCAACCGCCGCCCGGTT U15992 
196-230-F CTGTGCATGCCATGTTTTCGGAGAGGACG AF076919 
196-1140-R CCCGAGCTCAAAGGATAAAGGCAAAATGCC AF076910 
Close Modal

or Create an Account

Close Modal
Close Modal