Skip to Main Content
Table 1.
Primer sequences used in this study
TargetForward primer (5′–3′)Reverse primer (5′–3′)
hZMPSTE24              TGTACCACCGGAGTTAGGACA                AGCCAGCATAACCACAGAACC 
hIFITM1              ATCAACATCCACAGCGAGAC                CAACCATCTTCCTGTCCCTAG 
hIFITM2              GATGTCCACCGTGATCCAC                CAACCATCTTCCTGTCCCTAG 
hIFITM3              CCAACCATCTTCCTGTCCC                ATGTCGTCTGGTCCCTGTTC 
mZMPSTE24              GCCTGGCTGTTCACATTAGTT                GGAACGCTTAGATCCTTCAACAA 
hGAPDH              AGGTGAAGGTCGGAGTCA                GGTCATTGATGGCAACAA 
mIL-6              TGGGGCTCTTCAAAAGCTCC                AGGAACTATCACCGGATCTTCAA 
mIFNβ              CAGCTCCAAGAAAGGACGAAC                GGCAGTGTAACTCTTCTGCAT 
mTNFα              TACTGAACTTCGGGGTGATTGGTCC                CAGCCTTGTCCCTTGAAGAGAACC 
mKC              TGCACCCAAACCGAAGTCAT                TTGTCAGAAGCCAGCGTTCAC 
mMCP1              ACCACAGTCCATGCCATCAC                TTGAGGTGGTTGTGGAAAAG 
mL32              AAGCGAAACTGGCGGAAAC                TAACCGATGTTGGGCATCAG 
mIFITM3              CCCCCAAACTACGAAAGAATCA                ACCATCTTCCGATCCCTAGAC 
Rescue              CCGACTACATTGCCCCTTTATTTGAC                CGTAAATGGTGACAAGAACCAGAGAC 
PR8 IAV NP              GCGTCTCAAGGCACCAAAC                TCAAAAGCAGAGAGCACCATT 
TargetForward primer (5′–3′)Reverse primer (5′–3′)
hZMPSTE24              TGTACCACCGGAGTTAGGACA                AGCCAGCATAACCACAGAACC 
hIFITM1              ATCAACATCCACAGCGAGAC                CAACCATCTTCCTGTCCCTAG 
hIFITM2              GATGTCCACCGTGATCCAC                CAACCATCTTCCTGTCCCTAG 
hIFITM3              CCAACCATCTTCCTGTCCC                ATGTCGTCTGGTCCCTGTTC 
mZMPSTE24              GCCTGGCTGTTCACATTAGTT                GGAACGCTTAGATCCTTCAACAA 
hGAPDH              AGGTGAAGGTCGGAGTCA                GGTCATTGATGGCAACAA 
mIL-6              TGGGGCTCTTCAAAAGCTCC                AGGAACTATCACCGGATCTTCAA 
mIFNβ              CAGCTCCAAGAAAGGACGAAC                GGCAGTGTAACTCTTCTGCAT 
mTNFα              TACTGAACTTCGGGGTGATTGGTCC                CAGCCTTGTCCCTTGAAGAGAACC 
mKC              TGCACCCAAACCGAAGTCAT                TTGTCAGAAGCCAGCGTTCAC 
mMCP1              ACCACAGTCCATGCCATCAC                TTGAGGTGGTTGTGGAAAAG 
mL32              AAGCGAAACTGGCGGAAAC                TAACCGATGTTGGGCATCAG 
mIFITM3              CCCCCAAACTACGAAAGAATCA                ACCATCTTCCGATCCCTAGAC 
Rescue              CCGACTACATTGCCCCTTTATTTGAC                CGTAAATGGTGACAAGAACCAGAGAC 
PR8 IAV NP              GCGTCTCAAGGCACCAAAC                TCAAAAGCAGAGAGCACCATT 
Close Modal

or Create an Account

Close Modal
Close Modal