Skip to Main Content
Table 1.
Gene-specific primers used in qRT-PCR experiments
GeneForward primer (5′–3′)Reverse primer (5′–3′)
Il6 CACAGAGGATACCACTCCCAACA TCCACGATTTCCCAGAGAACA 
Tnf CATCTTCTCAAAATTCGAGTGACAA CCAGCTGCTCCTCCACTTG 
Il12p35 ACTAGAGAGACTTCTTCCACAACAAGAG GCACAGGGTCATCATCAAAGAC 
Il12p40 GGAGACACCAGCAAAACGAT TCCAGATTCAGACTCCAGGG 
Il10 CCAGAGCCACATGCTCCTAGA GGTCCTTTGTTTGAAAGAAAGTCTTC 
Il23p19 GCCAAGAAGAC CATTCCCGA TCAGTGCTACAATCTTCTTCAGAGGACA 
Arg1 TTTTTCCAGCAGACCAGCTT AGAGATTATCGGAGCGCCTT 
Mrc1 CAGGTGTGGGCTCAGGTAGT TGGCATGTCCTGGAATGAT 
Nfkb2 CATCCATGACAGCAAGTCTC TCCTCATAGAACCGAACCTC 
Relb GAATGTCGTCAGGATCTGC TGGTGGACTTCTTGTCGTAG 
Map3k14 GTACTTCCGAGGCCCGCTTT GTGGACGGGCTCTTTCCTCA 
GeneForward primer (5′–3′)Reverse primer (5′–3′)
Il6 CACAGAGGATACCACTCCCAACA TCCACGATTTCCCAGAGAACA 
Tnf CATCTTCTCAAAATTCGAGTGACAA CCAGCTGCTCCTCCACTTG 
Il12p35 ACTAGAGAGACTTCTTCCACAACAAGAG GCACAGGGTCATCATCAAAGAC 
Il12p40 GGAGACACCAGCAAAACGAT TCCAGATTCAGACTCCAGGG 
Il10 CCAGAGCCACATGCTCCTAGA GGTCCTTTGTTTGAAAGAAAGTCTTC 
Il23p19 GCCAAGAAGAC CATTCCCGA TCAGTGCTACAATCTTCTTCAGAGGACA 
Arg1 TTTTTCCAGCAGACCAGCTT AGAGATTATCGGAGCGCCTT 
Mrc1 CAGGTGTGGGCTCAGGTAGT TGGCATGTCCTGGAATGAT 
Nfkb2 CATCCATGACAGCAAGTCTC TCCTCATAGAACCGAACCTC 
Relb GAATGTCGTCAGGATCTGC TGGTGGACTTCTTGTCGTAG 
Map3k14 GTACTTCCGAGGCCCGCTTT GTGGACGGGCTCTTTCCTCA 
Close Modal

or Create an Account

Close Modal
Close Modal