Skip to Main Content
Table I.

Oligonucleotides


Oligo no.

Oligo name

Sequences
36 Sso1 kan TTACAATTAAAAAAGGCAATTAAAAATAGAAACAAATCAAATGAGT
     TATAATAATGCTTGCCTCGTCCCCGCCGCGTCA 
37 kan Sso1 TTGATATACAAAAGGGGAGTTCGGATAGAATAGAAATATAGAAAAT
     AGTTGGAAGCGCACTTAACTTCGGATCTGGGCAG 
41 Sso1-4 GAGATATCCTCGAGACGCGTTTTGACAACAGCTGGG 
42 Sso1-7 GCGAATTCCTCGAGCTTAATGGACTTCCTGGAGGAGG 
43 Sso1-8 CGTCTAGAGCGGCCGCGAATGAGGTAGCATGTGAAAACG 
44 Sso1-9 GCGAATTCATGAATGCTAACAGACGTGG 
211 Sso1-14 GGTCCGGAAATGCTAACAGACGTGG 
216 Sso1-15 GGGAGCTCGCTTAATGGACTTCCTGGAGGAGG 
217 Sso1-16 CGTCTAGAGATTTGTTTCTATTTTTAATTGCC 
218 Sso1-17 GCCTCGAGTAATTCCAACTATTTTCTATATTTC 
219 Sso1-18 CCGGTACCGAGGTAGCATGTGAAAACGCGGGAG 
113 Sec9c-1 CGCCATGGAATTCATGCAGCGTGGTTACAAAAC 
179 Sec9c-3 TAGGATCCCCTCCGGAGATATCGATACGTATACCTGCCAGACGG 
180 Sec9c-4 CCATCGATCTGAACCGTTCTATCCTGGC 
181 Sec9c-5 TAGGATCCCCTCCGGAGTCATCTTCTTCATCGTTCTC 
301 EcoRI-Syn1A-Sso1 GCGAATTCATGAAGGACCGAACCCAGG 
302 Syn1A-Sso1-ClaI GCTCCGGAATCGATGATACCAGAGGCAAAGATG 
325 Sec9c Q468Rf GGGTATGCTGGGTCATCGATCTGAACAGCTGAAC 
326
 
Sec9c Q468Rr
 
GTTCAGCTGTTCAGATCGATGACCCAGCATACCC
 

Oligo no.

Oligo name

Sequences
36 Sso1 kan TTACAATTAAAAAAGGCAATTAAAAATAGAAACAAATCAAATGAGT
     TATAATAATGCTTGCCTCGTCCCCGCCGCGTCA 
37 kan Sso1 TTGATATACAAAAGGGGAGTTCGGATAGAATAGAAATATAGAAAAT
     AGTTGGAAGCGCACTTAACTTCGGATCTGGGCAG 
41 Sso1-4 GAGATATCCTCGAGACGCGTTTTGACAACAGCTGGG 
42 Sso1-7 GCGAATTCCTCGAGCTTAATGGACTTCCTGGAGGAGG 
43 Sso1-8 CGTCTAGAGCGGCCGCGAATGAGGTAGCATGTGAAAACG 
44 Sso1-9 GCGAATTCATGAATGCTAACAGACGTGG 
211 Sso1-14 GGTCCGGAAATGCTAACAGACGTGG 
216 Sso1-15 GGGAGCTCGCTTAATGGACTTCCTGGAGGAGG 
217 Sso1-16 CGTCTAGAGATTTGTTTCTATTTTTAATTGCC 
218 Sso1-17 GCCTCGAGTAATTCCAACTATTTTCTATATTTC 
219 Sso1-18 CCGGTACCGAGGTAGCATGTGAAAACGCGGGAG 
113 Sec9c-1 CGCCATGGAATTCATGCAGCGTGGTTACAAAAC 
179 Sec9c-3 TAGGATCCCCTCCGGAGATATCGATACGTATACCTGCCAGACGG 
180 Sec9c-4 CCATCGATCTGAACCGTTCTATCCTGGC 
181 Sec9c-5 TAGGATCCCCTCCGGAGTCATCTTCTTCATCGTTCTC 
301 EcoRI-Syn1A-Sso1 GCGAATTCATGAAGGACCGAACCCAGG 
302 Syn1A-Sso1-ClaI GCTCCGGAATCGATGATACCAGAGGCAAAGATG 
325 Sec9c Q468Rf GGGTATGCTGGGTCATCGATCTGAACAGCTGAAC 
326
 
Sec9c Q468Rr
 
GTTCAGCTGTTCAGATCGATGACCCAGCATACCC
 
Close Modal

or Create an Account

Close Modal
Close Modal