Skip to Main Content
Table I.

Primers and cDNA products for construction of Pax7-deletion mutants

cDNA
Forward primer (5′→3′)/target location (nt)
Reverse primer (5′→3′)/target location (nt)
FL GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔN GGATCCGGGAAGAAAGAGGACGACGAG/487–507 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔC GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTATCCTGCCTGCTTGCGCCA/811–828 
ΔHD   
    N-Pax7a GGATCCATGGCGGCCCTTCCC/1–15 CTGGTTAGCGCGCTGCTTGCGCTTCAG/631–648 
    C-Pax7b AAGCAGCGCGCTAACCAGCTGGCCGCC/826–843 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
    ΔHDc GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔNO GGATCCCAGCGCCGCAGTCGGACC/643–660 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔNHD GGATCCGCTAACCAGCTGGCCGCC/826–843 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
cDNA
Forward primer (5′→3′)/target location (nt)
Reverse primer (5′→3′)/target location (nt)
FL GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔN GGATCCGGGAAGAAAGAGGACGACGAG/487–507 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔC GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTATCCTGCCTGCTTGCGCCA/811–828 
ΔHD   
    N-Pax7a GGATCCATGGCGGCCCTTCCC/1–15 CTGGTTAGCGCGCTGCTTGCGCTTCAG/631–648 
    C-Pax7b AAGCAGCGCGCTAACCAGCTGGCCGCC/826–843 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
    ΔHDc GGATCCATGGCGGCCCTTCCC/1–15 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔNO GGATCCCAGCGCCGCAGTCGGACC/643–660 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 
ΔNHD GGATCCGCTAACCAGCTGGCCGCC/826–843 CTCGAGCTAGTAGGCTTGTCCCGTTTCCAC/1489–1512 

GGATCC, BamHI recognition site; CTCGAG, XhoI recognition site.

a

N terminus/paired box/octapeptide.

b

Transactivation domain.

c

N-Pax7/C-Pax7 template.

Close Modal

or Create an Account

Close Modal
Close Modal